Back To The Dataset

  • Official Symbol: DDX5
  • Official Name: DEAD-box helicase 5
  • Aliases & Previous Symbols: NA
  • NCBI gene: 1655
  • Uniprot: P17844
Expression Level in NALM6: 12.55
Essentiality Rank in NALM6: 900

Classical Gene Deletion Experiments




ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
285 knockout Guide 1 AAGTCTACTTGTATCTACGG 6.02 7.08
286 knockout Guide 2 CTGATAGGCAAACTCTAATG 5.85 7.08