Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
285 knockout Guide 1 AAGTCTACTTGTATCTACGG 6.02 7.08
286 knockout Guide 2 CTGATAGGCAAACTCTAATG 5.85 7.08

choose the guide for the x-axis
choose the guide for the y-axis