Back To The Dataset

  • Official Symbol: TOP2A
  • Official Name: DNA topoisomerase II alpha
  • Aliases & Previous Symbols: NA
  • NCBI gene: 7153
  • Uniprot: P11388
Expression Level in NALM6: 11.91
Essentiality Rank in NALM6: 1059

Classical Gene Deletion Experiments




ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
329 knockout Guide 1 TCCCGTCAGAACATGGACCC 5.48 7.63
330 knockout Guide 2 AGCATTGTAAAGATGTATCG 4.85 7.23

Gene Deletion in Presence of Chemical Perturbation


Compound Concentration Unit Plot Page
Doxorubicin 9.0 nM Plot Results