Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
329 knockout Guide 1 TCCCGTCAGAACATGGACCC 5.48 7.63
330 knockout Guide 2 AGCATTGTAAAGATGTATCG 4.85 7.23

choose the guide for the x-axis
choose the guide for the y-axis