Back To The Dataset

  • Official Symbol: BANF1
  • Official Name: BAF nuclear assembly factor 1
  • Aliases & Previous Symbols: NA
  • NCBI gene: 8815
  • Uniprot: O75531
Expression Level in NALM6: 9.77
Essentiality Rank in NALM6: 1020

Classical Gene Deletion Experiments




ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
273 knockout Guide 1 GTCCCGGGACTGCTTGGCGT 3.89 3.67
274 knockout Guide 2 GAATGGCTGAAAGACACTTG 3.61 3.61