Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
273 knockout Guide 1 GTCCCGGGACTGCTTGGCGT 3.89 3.67
274 knockout Guide 2 GAATGGCTGAAAGACACTTG 3.61 3.61

choose the guide for the x-axis
choose the guide for the y-axis