Back To The Dataset

  • Official Symbol: RBM26
  • Official Name: RNA binding motif protein 26
  • Aliases & Previous Symbols: NA
  • NCBI gene: 64062
  • Uniprot: Q5T8P6
Expression Level in NALM6: 10.52
Essentiality Rank in NALM6: 11498

Classical Gene Deletion Experiments




ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
323 knockout Guide 1 AAACGGTGTAGAGACTATGA 5.6 7.27
324 knockout Guide 2 TCTTACCTGTAAGTTAACCA 5.39 7.47