Back To The Dataset

  • Official Symbol: MAPK14
  • Official Name: mitogen-activated protein kinase 14
  • Aliases & Previous Symbols: NA
  • NCBI gene: 1432
  • Uniprot: Q16539
Expression Level in NALM6: 10.02
Essentiality Rank in NALM6: 5214

Classical Gene Deletion Experiments




ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
297 knockout Guide 1 CAAGGCGAGTAATACCTGTC 5.95 7.58
298 knockout Guide 2 TGATGAAATGACAGGCTACG 6.23 7.55