Back To The Dataset


  • Official Symbol: LONP1
  • Official Name: lon peptidase 1, mitochondrial
  • Aliases & Previous Symbols: NA
  • NCBI gene: 9361
  • Uniprot: P36776
Expression Level in NALM6: 10.37
Essentiality Rank in NALM6: 926

Classical Gene Deletion Experiments


Plot Results
ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
295 knockout Guide 1 CCGAGAATGCGCCTCCGCCG 5.33 7.39
296 knockout Guide 2 GGAGGAAGACCACTACGGCA 5.24 5.08