Back To The Dataset


  • Official Symbol: SMARCD1
  • Official Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
  • Aliases & Previous Symbols: NA
  • NCBI gene: 6602
  • Uniprot: Q96GM5
Expression Level in NALM6: 10.1
Essentiality Rank in NALM6: 1424

Classical Gene Deletion Experiments


Plot Results
ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
327 knockout Guide 1 GAAACGGCTAGATATCCAAG 5.65 7.2
328 knockout Guide 2 TATTAAGACACATAAGCTCC 5.7 7.25