Back To The Dataset


  • Official Symbol: FAM172A
  • Official Name: family with sequence similarity 172 member A
  • Aliases & Previous Symbols: NA
  • NCBI gene: 83989
  • Uniprot: Q8WUF8
Expression Level in NALM6: 7.32
Essentiality Rank in NALM6: 18772

Classical Gene Deletion Experiments


Plot Results
ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
291 knockout Guide 1 AAGATACGAGGCTCTAGGAG 5.54 7.51
292 knockout Guide 2 TCATGGTAGTGGTGTTGTCA 5.47 7.54