Back To The Dataset


  • Official Symbol: PARP1
  • Official Name: poly(ADP-ribose) polymerase 1
  • Aliases & Previous Symbols: NA
  • NCBI gene: 142
  • Uniprot: P09874
Expression Level in NALM6: 11.8
Essentiality Rank in NALM6: 3617

Classical Gene Deletion Experiments


Plot Results
ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
307 knockout Guide 1 AGCTAGGCATGATTGACCGC 4.96 5.84
309 knockout Guide 2 ATCTTGGACCGAGTAGCTGA 5.16 5.84
310 knockout Guide 1 AGCTAGGCATGATTGACCGC 5.34 7.47
311 knockout Guide 2 ATCTTGGACCGAGTAGCTGA 5.44 7.37

Gene Deletion in Presence of Chemical Perturbation


Compound Concentration Unit Plot Page
Camptothecin 5.0 nM Plot Results