Back To The Dataset

  • Official Symbol: TP53
  • Official Name: tumor protein p53
  • Aliases & Previous Symbols: NA
  • NCBI gene: 7157
  • Uniprot: P04637
Expression Level in NALM6: 9.76
Essentiality Rank in NALM6: 16798

Classical Gene Deletion Experiments




ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
302 knockout Guide 1 GAGCGCTGCTCAGATAGCGA 4.93 5.9
303 knockout Guide 2 CCAGTTGCAAACCAGACCTC 5.32 5.79