Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
305 knockout Guide 1 GCAGCACGGTGGCGATACGA 3.71 5.3
306 knockout Guide 2 GGTCTTGATCACCCGCACTA 4.49 5.33

choose the guide for the x-axis
choose the guide for the y-axis