Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
335 knockout Guide 1 CACATGAGCCGGATTCACGG 5.63 7.62
336 knockout Guide 2 ACATCAGTATAAGAGGTGCT 5.26 7.78

choose the guide for the x-axis
choose the guide for the y-axis