Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
299 knockout Guide 1 AGACACTTATACTATGAAAG 3.46 5.68
300 knockout Guide 1 AGACACTTATACTATGAAAG 1.67 4.74

choose the guide for the x-axis
choose the guide for the y-axis