Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
293 knockout Guide 1 TCAGCCAATATTTCTGTGCG 5.53 6.02
294 knockout Guide 2 CACACCAATGGTGTCCCCCA 5.38 5.84

choose the guide for the x-axis
choose the guide for the y-axis