ADK


Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
272 knockout Guide 2 AAAGTCGAATATCATGCTGG 5.04 5.72
353 knockout Guide 1 ACAGCAGAGATGTCAAGCAG 4.88 5.51

choose the guide for the x-axis
choose the guide for the y-axis