Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
283 knockout Guide 1 CGTGGACGGAGTGATTACGA 6.06 7.47
284 knockout Guide 2 GCACCACCATAAACCACGCA 5.8 7.46

choose the guide for the x-axis
choose the guide for the y-axis