Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
333 knockout Guide 1 TGTTTCAGCTAATCTCTCGG 5.77 7.52
334 knockout Guide 2 TGTAGTGCCTTAATACGTCC 6.05 7.11

choose the guide for the x-axis
choose the guide for the y-axis