Back To The Dataset


Classical Gene Deletion Experiments


ExpID Experiment Condition sgRNA guides Sequence Doublings (day 5 to day 15) Doublings (day 15 to day 23)
281 knockout Guide 1 TAGATATTGATACTAGACGC 4.47 6.45
282 knockout Guide 2 CAGATGGCTGTAACAAAACG 3.59 5.03

choose the guide for the x-axis
choose the guide for the y-axis